Snowmen in the Lab

Erlenmeyer's Early Experiments

Two minutes of web searching revealed the amazing fact that Emil Erlenmeyer and Robert Bunsen, two giants of lab equipment, worked in the same laboratory in the 1850s.  During that time Erlenmeyer converted his backyard shed into a lab so he could mentor students (something not allowed in the Bunsen Laboratory).

Human Chromosome vs. Human Nucleus (Part II)

I previously posted an image I made of a human cheek cell compared to the length of chromosome 21...the smallest chromosome.  Here's a new version of that image featuring the largest piece of DNA in the nucleus, chromosome 1.  (Click on the image below to see a full-sized image.)

Pretty impressive!  The small blue shape in the center of the image is a human cheek cell.  The nucleus is visible as a small, dark blue spot at the center.  The thin line looping around the cell represents the length of chromosome 1.  Chromosome 1 is about 248 mega basepairs (mbp, 248,000,000 base pairs).  To see how I calculated the length of the chromosome line see my previous post about chromosome 21.

I added some additional features to this image.  The thicker grey line represents the centromere of chromosome 1 which is approximately 7 mbp...about 3% of the total length of the chromosome.  The small green tick marks on the upper left of the chromosome line represents the exons of the largest gene on chromosome 1.  The gene is AGBL4 and it stretches across about 1.5 mbp.  The product of AGBL4 is involved in chemical modification of proteins and mutations in AGBL4 are associated with age-related macular degeneration.  Notice that most of the DNA base pairs in the AGBL4 region of the chromosome are non-coding introns.

Bottom line...chromosome 1 is big!  Two copies of chromosome 1 fold up to fit inside the nucleus of every human cell.  And there are 44 other chromosomes folded up in there too!

A Stir Bar Love Story

Here's a clip from a talk I gave for the @ScienceAfterDarkSLO.  (I really do enjoy working with undergraduates in the lab...).  You can see another clip from this talk in an earlier post.


In addition to the stir plate and stir bar, I also show the micro centrifuge in the cartoon.  Here are some centrifuge cartoons.

The character on the right with the striped shirt appears in another of my centrifuge-related cartoon.

Olympics of Molecular Biology

In honor of the Games in Rio, here are some cartoons I drew in 2000 (Sydney Olympics).

This Week in Lab...August 5, 2016

Spaghetti Cell

What is it like inside a cell?  In my experience students come to my Introductory Cell Biology course picturing a cell as a bag of water with things floating around inside.  Maybe that isn't surprising since many of the structures inside cells (especially the cytoskeleton) aren't visible in a light microscope.

To help students develop a more accurate conception of what it's like inside a (eukaryotic) cell I started asking them to imagine a plate of spaghetti and meatballs stuffed into a small plastic bag.  There would be no empty space and nothing would be 'floating around' in there.

After using this analogy for a while I decided...why not do it as a demo.  Here's a video from lecture:

I always use a clean bag and gloves so I can eat the spaghetti for lunch later.  The meatballs represent organelles while the noodles taking up most of the space in the bag represent cytoskeleton.  I do this demo before covering motor proteins.  The spaghetti bag helps students understand the role of motor proteins...when large structures move inside a cell they are being dragged through a dense matrix.

Biology + Emoji

Electron transport and ATP synthase depicted in emoji by a student.

I teach the Introductory Cell Biology course at Cal Poly.  There were 170 students enrolled this quarter.  With about two weeks left in the course I gave them this extra credit challenge:

"Use standard emoji to illustrate concepts from the class."

Responses were submitted by email (and there was an alternative way for students without phones or computers to participate).  About half the students submitted a response to the challenge.  Grades were based on accuracy and creativity.  Out of 5 possible points most got 3 or 4...I reserved full points for the truly elegant examples.  Here are some of my favorites:

Central Dogma:
Here's an nice take on the good ol' central dogma.  Information from a cookbook (DNA) is copied down (RNA) then used to produce a meal (protein/function).

Genetics:
A nice monohybrid cross...with Mendel at the top making careful observations.

Another monohybrid cross with the alleles shown as a strong arm (dominant) or a thumbs down (recessive).  It's cute but would have been better if the heterozygous F1 was shown.

Translation: "A father can only give X-linked genes to daughters."

Metabolism:
In addition to the electron transport chain (shown at the top of this post) students tackled...
hydrolysis reactions:

Photosynthesis and respiration in plants:

This one follows an electron in the light reaction through two rounds of excitation (at photosystem II and photosystem I).  The final fate of the electron is to reduce NADP⁺..."joining the family" at the end.

Difusion and Osmosis:

A system going toward equilibrium:

And here is osmosis equalizing sugar concentrations across a phospholipid bilayer. 

Cell Division:

Last are some nice takes on mitosis...

And meiosis...this one does a particularly nice job of depicting sister chromatids, homologous chromosomes, and the reduction of chromosome number:

What do you think of this assignment?  What basic cell biology concepts would YOU like to see illustrated with emoji?  Please comment and let me know.

Central Coast Science After Dark

I enjoyed giving a science cartoon talk at the Central Coast Science After Dark meeting this week.  Part of the talk involved crowd-sourcing a cartoon.  The group chose the following criteria:

• Setting: Undergraduate Field Trip
• Dominant Emotion: Confusion
• Timing: Something has just happened
• Variable: Cephalopod (octopus or squid)

Here's the result...ready for your caption suggestions! (click to see a larger image.)

I pictured a Cal Poly Marine Science class at the tide pools.  I think I might have been channeling my inner Charles Addams a little bit for this cartoon.  Please use the Comment area at the bottom of this page to suggest a caption.

Here's a short clip from the Science After Dark talk (the audio cuts out for a few seconds).  The talk covered life in the lab, grant writing, the Human Genome Project, Next-Generation sequencing, and teaching genetics...all in cartoon form.

My Favorite Y-linked Pedigree...Part 2

This example is adapted from Wang, et al, (2013), American Journal of Human Genetics, 92 (2), pg. 301-306.

In My Favorite Y-linked Pedigree (Part 1) I described how I use the pedigree below in class.  The shaded shapes in the pedigree are deaf.  Interestingly, deafness in this family is Y-linked (you can observe that deafness is only passed from fathers to sons).

In this post I'll show how I use this pedigree as an introduction to chromosome biology and gene dosage. A nice benefit is that the approach described below also lets the students see how a common bioinformatic tool (the BLAST algorithm) can be used to help solve biological problems.

By sequencing the Y chromosomes of relatives in this family with normal hearing and hearing impairment, the researchers determine that the deaf individuals' Y chromosomes carry extra DNA.  At this point an instructor could just say what this extra DNA is...but several fun teaching and learning opportunities would be missed.

The text box below displays the sequence of some of the extra Y-chromosome DNA.  This is not the complete sequence.  The complete insert is about 160 kb (160,000 base pairs).

GCAAACGGGGCCGGAAAGCGTGGCAGCGCAGGCGCAAGCGCAGAGAGCGGAGGCGGTGGTGGTGGCGGCCGCTGGCCAGTGTAAGATGGCGGCGGCGTTGGTGGTGGCAGTGGACGGGGCGGCTGGGCCTGGAACAGTCGGAGCAGCCGCTAGCAGAAGGATGACCCAAGACGGGAAGCGGGCTGCTGAGCCTCGCCGATTCCCGTGCTTGTAACTGCCCCAGCCGGACACCCCCCCTCCCTTGACCTACCCGGTCTGTGTCTCGTTCCGGCTCGGCCTGCGCCCCCCCTCGCTTCCCAGCCGGTTTCCCCTAAGGATGGGCCTGACCCGTATCCCAAGCTCTTAGCGCTCAGGTCTTTTCCTTCCGCCGACCCGAAGTCATCGCTGGGAGTACTGGTTGCCCTTTCCTCAGGTCAGCCCTGGTGTTGCCCCCAAGAGCCAGCCGCACAGTTCACAGGGACGCCTTGCTTCGTTGGGTGACCCATGTGTGCGCTCCTATTTCTCCCCTTAGATTGAGGGACACGGCTCGCCCTGCGTCTCCCCGTCACCTCAGGGCCACCGCGCAATGTGTCCCCCTCCCCCATCCCAAGTTCCCAGGCCCAGCACCTTGTACGGAAGGCGGAGGTCCAAGAATTCCGGAGTCGGTTGTTGTCTTGTGGTCTTGTACCCTTTGTAATATAATTATCTTAGTTTACCTCCTCTAACTCCCAAATCTTTTAGGATATCTTAGAACGGTCCCATTTGGTCCCTGTTAGTTGGAAAGCATCTGGTGGCTTGAATTTCTGACTCATGATTGTTACTGGAGTCTCTGTAAACAAACCGGCACTAGCGCTATCACATTCTCTCCGGGATTTCCCCCCCTGCTCTGTGGCTTCTTGTTGAGAGGTTGTTTGGTTATGGTTTAGCGTTGAAAAGATTCAGGTTATCCTTTTAAATGACTTTACGTTTTAGTGGAGCTGGGAGATTACTTGCCTGGCTTCTAATCTTCATGTTGGTTCATTTTATTTCCATATGTGTGTGGGTTATTTGTTCAGTAATTAGAATTAGATAAAGTATTCTGCTTTTAAGTAGTTTTGAGAAGGCCTAAAAATACTAAAGTGTATTCATAAATATTTTTATTATGTTCAGTAGAAGACACACCTTTGCCATGTAAATTTTAACTTTTCTCAGTCCTTCAGTGAATCTACAGACCTATTTTCTCAGGAGCTCAGCCTGGCCTTACTTCAGTGATAAAAGGAGGAAAGGTGAGT

What is this sequence?  Where is it from?  What does it encode?  How does it relate to hearing? We can start to answer these questions through simple but powerful analysis...searching the genome database for a match. Copy the sequence then paste it into a nucleotide BLAST (blastn) to search for a match in the human genome:

1. Go to the BLAST home page at NCBI (National Center for Biotechnology Information)
2. Select "Human" from the menu of organisms on the top right of the screen.
3. Paste the sequence above into the "Enter Query Sequence" window and click "BLAST" at the bottom of the page.

Here's some sample output.  The query sequence is from the Y of deaf individuals. The BLAST search reveals that that sequence originates from chromosome 1.

So the extra DNA on the Y chromosome of deaf individuals originates from chromosome 1.  This is an example of a translocation.  The translocated region of chromosome 1 includes a region called DFNA49 that contains several genes associated with hearing and ear development.  The figure below compares chromosomes 1 and Y from individuals with normal and impaired hearing.

The deaf individuals in the pedigree DO NOT have mutant alleles of DFNA49...they simply have too many copies.  Presumably it is the increased gene dosage of DFNA49 that results in hearing loss.

The researchers use a technique called Fluorescence In Situ Hybridization (FISH) to confirm that DFNA49 is present on the Y of deaf individuals.  In the images below (normal hearing on the left, deaf on the right) the DFNA49 shows up as glowing yellow spots.  On the left, spots are only seen associated with two chromosomes corresponding to the two copies of DFNA49 on chromosome 1.  On the left three spots are seen...on both copies of chromosome 1 and on the Y.

From Wang, et al, 2013 (see full reference above).  Yellow dots indicate the location of the DFNB1 locus.  The chromosomes on the left are from an individual with normal hearing.  The left shows chromosomes from an individual with hearing impairment.

To sum up...this Y-linked pedigree serves several purposes in my teaching:

• It challenges students to develop an explanation about inheritance based on evidence.
• It allows me to demonstrate BLAST, a central tool in bioinformatics.
• It provides a vivid example of translocation.
• It emphasizes the importance of gene dosage...extra copies of genes can affect phenotypes!

If you can think of other ways to use this Y-linked pedigree or if you have a favorite example of translation or gene dosage, please consider leaving a comment.  Thanks!

Human Chromosome vs. Human Nucleus

I made this image to use in my genetics class.  In the center is an image of a human cheek cell stained with methylene blue.  The line running around the cell shows the length of human chromosome 21 (the smallest chromosome) relative to the cheek cell.  (Click the image for a larger view.)

Check out Part II of this post to see how this image would look with the biggest chromosome in the human nucleus (chromosome 1).

Pretty cool! The nucleus looks so tiny. And of course there's not one but two copies of chromosome 21 packed in there. And 44 other chromosomes too...all of which are longer than chromosome 21. Chromosome 1, the longest human chromosome, is 5.3 times longer than chromosome 21.

Calculations:
I found information on human chromosome size from the statistics associated with the most recent version of the human genome (hg38).  I found a couple of diameters for human cheek cells on-line and took the middle value of 50 μm (microns...a millionth of a meter).

Chromosome 21 is 46,709,983 bp (base pairs) in length.  The length of a nucleotide incorporated in DNA is 0.34 nm (nanometers...a billionth of a meter).

Using Photoshop I made the cheek cell 1 inch wide (2.54 cm).  So if 50um = 1 inch then chromosome 21 would be 158.8 inches (403.5 cm).  I drew the line using Adobe Illustrator and kept adding to it until the total length was 158.8 inches.